WormMine: Gene WBGene00039593

• WormBase Gene ID: WBGene00039593
• Gene Name: Cbr-gst-39
• Sequence Name: CBG20648
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Glutathione S-transferase, C-terminal domain; Glutathione S-transferase, N-terminal domain; Glutathione S-transferase, C-terminal domain superfamily; Thioredoxin-like superfamily; Glutathione S-transferase, N-terminal; and Glutathione S-transferase, C-terminal. Is an ortholog of C. elegans gst-39.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20648.1	CBG20648.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20648	CBG20648		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1052926
• Remark: Cbr-gst-39, GAGCATCCAAAGCTCACTGCTCTTCGTGAGAAAGTCTACGCAATTCCAGCCATCAAGACC, WBGene00039593
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term