WormMine: Gene WBGene00052226

• WormBase Gene ID: WBGene00052226
• Gene Name: Cre-spe-39
• Sequence Name: CRE30912
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Vps16, C-terminal domain superfamily and Spermatogenesis-defective protein 39. Is an ortholog of C. elegans spe-39. In C. elegans, spe-39 is involved in germ cell development; vacuolar protein processing; and vacuolar transport.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE30912.1	CRE30912.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE30912	CRE30912		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1112087
• Remark: Cre-spe-39, TCATTGAAACCAAATTCGGTTGAATCGTTTAAGGCGGTCGCTGCTCTCAATAATCCTTCT, WBGene00052226
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term