WormMine: Gene WBGene00052049

• WormBase Gene ID: WBGene00052049
• Gene Name: Cre-pccb-1
• Sequence Name: CRE00922
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Carboxyl transferase domain; Acetyl-CoA carboxylase; and ClpP/crotonase-like domain superfamily. Is an ortholog of C. elegans pccb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE00922.1	CRE00922.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE00922	CRE00922		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1099465
• Remark: Cre-pccb-1, AGGTGTGCGAGGACTTGAACATGCTCGAGAGCAAGAAGTTGAAGAACCCATGGAAGAAGC, WBGene00052049
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term