WormMine: Gene WBGene00119697

• WormBase Gene ID: WBGene00119697
• Gene Name: CJA00493
• Sequence Name: CJA00493
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Ankyrin repeat-containing domain superfamily. Is an ortholog of C. elegans daf-25. In C. elegans, daf-25 is involved in several processes, including dauer exit; positive regulation of cGMP-mediated signaling; and protein localization to cell periphery.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA00493.1	CJA00493.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA00493	CJA00493		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1082256
• Remark: CJA00493, AACCTGACAATAGTGGAGAAAGCGATCGAGCTGGGATGTGATGTGAATGAGAAAACGAGA, WBGene00119697
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term