WormMine: Gene WBGene00032215

• WormBase Gene ID: WBGene00032215
• Gene Name: CBG11004
• Sequence Name: CBG11004
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Immunoglobulin E-set; SNF1 protein kinase subunit beta-2/beta-3; AMP-activated protein kinase, glycogen-binding domain; Transactive response DNA-binding protein N-terminal domain; TAR DNA-binding protein 43, N-terminal; Glycogen recognition site of AMP-activated protein kinase; and Immunoglobulin-like fold. Is an ortholog of C. elegans F46H5.7.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11004b.1	CBG11004b.1		[unknown]
Transcript:CBG11004a.1	CBG11004a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11004b	CBG11004b		[unknown]
CDS:CBG11004a	CBG11004a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064863
• Remark: CBG11004, CAGCGAAGAGAGCGAGGGCAGAGATTCCGAGAAGGAGAAGAACGATAGACAGATGGAGAA, WBGene00032215
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term