WormMine: Gene WBGene00177083

• WormBase Gene ID: WBGene00177083
• Gene Name: CJA21511
• Sequence Name: CJA21511
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Translation initiation factor IF- 2, domain 3; Translation initiation factor IF- 2; Translation initiation factor IF-2, domain 3 superfamily; Translation protein, beta-barrel domain superfamily; and Translation-initiation factor 2. Is an ortholog of C. elegans iffb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA21511.1	CJA21511.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA21511	CJA21511		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092010
• Remark: CJA21511, AAGAGCACAAGGCAGAATACGCGTGCATCTTGGCGTTTGACGTGAAAATTGAACGGGAGG, WBGene00177083
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term