WormMine: Gene WBGene00038907

• WormBase Gene ID: WBGene00038907
• Gene Name: CBG19737
• Sequence Name: CBG19737
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: FMP27, domain of unknown function DUF2405; Domain of unknown function (DUF2405); Golgi-body localisation protein domain; RNA pol II promoter Fmp27 protein domain; FMP27, C-terminal; and FMP27, GFWDK domain. Is an ortholog of C. elegans F31C3.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19737.1	CBG19737.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19737	CBG19737		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1061241
• Remark: CBG19737, GGTTGGATTTAGCGCTAGCTGTGAAGCAACGATGTAAACGAGTGCTCGTTCAACAGTTCA, WBGene00038907
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term