WormMine: Gene WBGene00053793

• WormBase Gene ID: WBGene00053793
• Gene Name: Cre-ctns-1
• Sequence Name: CRE01625
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Lysosomal cystine transporter; PQ-loop repeat; and PQ loop repeat. Is an ortholog of C. elegans ctns-1. In C. elegans, ctns-1 is involved in L-cystine transport; lysosome organization; and phagocytosis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE01625.1	CRE01625.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE01625	CRE01625		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113036
• Remark: Cre-ctns-1, CATTCTTCAAATGATTCTTCAAGCGATCAACGTCAACGATTGGTCTGCATTCTACGCGAA, WBGene00053793
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term