WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030278 Gene Name  CBG08497
Sequence Name  ? CBG08497 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Zinc finger, RING/FYVE/PHD-type; FYVE-type zinc finger; and Zinc finger, FYVE/PHD-type. Is an ortholog of C. elegans Y48G8AR.2. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG08497.1 CBG08497.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG08497 CBG08497   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG25406, TGGGATTCTCAAAGTTTCGTGCATTGTATCGTTCAAAAATGGGAATCAGAGATGTTTCGA, WBGene00086820   Expr1059500 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG08497, CAAATCCCAACTGTCGAACGTCGTCGAAGTGCTTTCGAAGGATCCAGAAGGTCAGGAAAA, WBGene00030278   Expr1068639 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term