WormMine: Gene WBGene00032401

• WormBase Gene ID: WBGene00032401
• Gene Name: CBG11247
• Sequence Name: CBG11247
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: C-type lectin-like/link domain superfamily; Lectin C-type domain; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans F52E1.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11247.1	CBG11247.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11247	CBG11247		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1064995
• Remark: CBG11247, CGACCTATCAATATCAACGTGGCGGATGGAAGACGTATGATTGCTCCAAAACATCTGCAA, WBGene00032401
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term