WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032365 Gene Name  Cbr-sqv-7
Sequence Name  ? CBG11203 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: Sugar phosphate transporter domain and Triose-phosphate Transporter family. Is an ortholog of C. elegans sqv-7. In C. elegans, sqv-7 is involved in several processes, including egg-laying behavior; proteoglycan biosynthetic process; and pyrimidine nucleotide-sugar transmembrane transport. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11203.8 CBG11203.8   [unknown]
Transcript:CBG11203.7 CBG11203.7   [unknown]
Transcript:CBG11203.6 CBG11203.6   [unknown]
Transcript:CBG11203.5 CBG11203.5   [unknown]
Transcript:CBG11203.4 CBG11203.4   [unknown]
Transcript:CBG11203.3 CBG11203.3   [unknown]
Transcript:CBG11203.2 CBG11203.2   [unknown]
Transcript:CBG11203.1 CBG11203.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11203 CBG11203   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-sqv-7, TTAAGAATCTGTTCGTCACCTATGTAGGAATGTTCTCAAGTGGAGATTACGTCTTTCAAT, WBGene00032365   Expr1059461 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG11204, GAAAAGAAGCCGTCAATTGTGGTCATTTGGATCCAACATTTTCGGGCGTCGAGGAGAACA, WBGene00032366   Expr1058268 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term