WormMine: Gene WBGene00035345

• WormBase Gene ID: WBGene00035345
• Gene Name: Cbr-cdt-1
• Sequence Name: CBG14978
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; DNA replication factor CDT1 like; DNA replication factor Cdt1, C-terminal; CDT1 Geminin-binding domain-like; and DNA replication factor Cdt1 C-terminal domain. Is an ortholog of C. elegans cdt-1. In C. elegans, cdt-1 is involved in positive regulation of nematode male tail tip morphogenesis.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG14978.1	CBG14978.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG14978	CBG14978		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1063729
• Remark: Cbr-cdt-1, GATCTGAAAAGTCCTAAAAAAGCCACGACATCGGGTGATGTGCCGTTGTCTCCGAAGAAG, WBGene00035345
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term