WormMine: Gene WBGene00056818

• WormBase Gene ID: WBGene00056818
• Gene Name: Cre-pid-5
• Sequence Name: CRE09268
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Peptidase M24; Creatinase/Prolidase N-terminal domain; Metallopeptidase family M24; Creatinase/aminopeptidase-like; Peptidase M24, C-terminal domain; C-terminal region of peptidase_M24; Creatinase, N-terminal; and Creatinase/Aminopeptidase P/Spt16, N-terminal. Is an ortholog of C. elegans pid-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE09268.1	CRE09268.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE09268	CRE09268		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1098841
• Remark: CRE09268, TTCCAAACCTCAATTCTTGTCAAGCAGATTCTGACACCTGAAGAGATTCTCTGGATCAAT, WBGene00056818
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term