WormMine: Gene WBGene00034146

• WormBase Gene ID: WBGene00034146
• Gene Name: Cbr-nlt-1
• Sequence Name: CBG13369
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: SCP-2 sterol transfer family; Lipid-binding protein POX18/UbiT/NSL-TP1; SCP2 sterol-binding domain; and SCP2 sterol-binding domain superfamily. Is an ortholog of C. elegans nlt-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG13369.1	CBG13369.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG13369	CBG13369		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058843
• Remark: Cbr-nlt-1, AGGAAAGATGAAGCTGAAAGGAAACATCGCCAAGGCCATGAAGCTCCGCACCATCCTCGA, WBGene00034146
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term