WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00034292 Gene Name  CBG13538
Sequence Name  ? CBG13538 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Transmembrane Fragile-X-F-associated protein. Is an ortholog of C. elegans T07A9.12. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG13538.1 CBG13538.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG13538 CBG13538   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG13537, ATCGGTTTCGTCGCCTATTTCATTTTTATCATCTATATGAGATCCTGTGTAGAATATAAG, WBGene00034291   Expr1050341 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG13538, GAAAACTCGGAAGTCGCCAATCAGAATACCTACTCCTTCATCTTCACACCAATCTGGATT, WBGene00034292   Expr1053510 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term