WormMine: Gene WBGene00055149

• WormBase Gene ID: WBGene00055149
• Gene Name: Cre-cls-3
• Sequence Name: CRE25337
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: TOG domain; Armadillo-type fold; CLASP N-terminal domain; Armadillo-like helical; and CLASP N terminal. Is an ortholog of C. elegans cls-3. In C. elegans, cls-3 is involved in astral microtubule organization and establishment of mitotic spindle localization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE25337.1	CRE25337.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE25337	CRE25337		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1106534
• Remark: CRE25337, GCCATGGTAAATCGAGTCGGGGAGCAGAGAATGGCACAGCATTTCACCAAACTCCCCAAA, WBGene00055149
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term