WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00036234 Gene Name  CBG16220
Sequence Name  ? CBG16220 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: zinc-finger of a C2HC-type and Zinc finger C2HC domain-containing protein. Is an ortholog of C. elegans M153.4. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG16220.1 CBG16220.1   [unknown]
Transcript:CBG16220.2 CBG16220.2   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG16220 CBG16220   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG16220, GCGGAGGCGACAAACGAGGTGTTGTGGAAGAATTCGCAAGGATTAATGGTCGAATGTGAA, WBGene00036234   Expr1056682 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CBG16221, GGCTACAAACCGGTCGAAAGCCACTGGAGACAAGGCGCTGCCAAGAGACTTCCGAAATAC, WBGene00036235   Expr1050059 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term