WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00024738 Gene Name  CBG01513
Sequence Name  ? CBG01513 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domain: Ankyrin repeat-containing domain superfamily. Is an ortholog of C. elegans F45F2.10. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

8 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG01513d.1 CBG01513d.1   [unknown]
Transcript:CBG01513e.1 CBG01513e.1   [unknown]
Transcript:CBG01513f.1 CBG01513f.1   [unknown]
Transcript:CBG01513g.1 CBG01513g.1   [unknown]
Transcript:CBG01513h.1 CBG01513h.1   [unknown]
Transcript:CBG01513a.1 CBG01513a.1   [unknown]
Transcript:CBG01513b.1 CBG01513b.1   [unknown]
Transcript:CBG01513c.1 CBG01513c.1   [unknown]
 

Other

8 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG01513a CBG01513a   [unknown]
CDS:CBG01513b CBG01513b   [unknown]
CDS:CBG01513c CBG01513c   [unknown]
CDS:CBG01513d CBG01513d   [unknown]
CDS:CBG01513e CBG01513e   [unknown]
CDS:CBG01513f CBG01513f   [unknown]
CDS:CBG01513g CBG01513g   [unknown]
CDS:CBG01513h CBG01513h   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CBG01513, AACAGGCAAATCACTCTCAACATCAACGTTTCCGAGACGGCTAGTCATCGATTCAAGGAT, WBGene00024738   Expr1066663 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term