WormMine: Gene WBGene00058657

• WormBase Gene ID: WBGene00058657
• Gene Name: Cre-gob-1
• Sequence Name: CRE15363
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: HAD-like superfamily; HAD superfamily; Trehalose-6-phosphate phosphatase N-terminal helical bundle domain; and Trehalose-6-phosphate phosphatase, helical bundle domain. Is an ortholog of C. elegans gob-1. In C. elegans, gob-1 is involved in carbohydrate derivative catabolic process and trehalose biosynthetic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15363.1	CRE15363.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15363	CRE15363		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1096985
• Remark: Cre-gob-1, TTGTGTTGCCGGAGATACTGCTAGTGATGTCCCAATGTTACAGAAAGCAGCAGAAGAGAA, WBGene00058657
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term