WormMine: Gene WBGene00058577

• WormBase Gene ID: WBGene00058577
• Gene Name: Cre-pag-3.1
• Sequence Name: CRE15406
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; C2H2-type zinc finger; Zinc finger C2H2 superfamily; and Zinc finger C2H2-type. Is an ortholog of C. elegans pag-3. In C. elegans, pag-3 is involved in several processes, including negative regulation of secretion by cell; neuroblast fate specification; and regulation of locomotion.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15406.1	CRE15406.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15406	CRE15406		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113488
• Remark: CRE07651, GAAAAGCGTTCAGCCAGTCTTCCAACCTGATCACCCATACAAGGAAGCATACCGGATTCA, WBGene00068463
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term