WormMine: Gene WBGene00038317

• WormBase Gene ID: WBGene00038317
• Gene Name: CBG19033
• Sequence Name: CBG19033
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Fibrinogen-like, C-terminal; C-type lectin-like/link domain superfamily; Lectin C-type domain; Fibrinogen, alpha/beta/gamma chain, C-terminal globular domain; Fibrinogen beta and gamma chains, C-terminal globular domain; C-type lectin-like; and C-type lectin fold. Is an ortholog of C. elegans T15B7.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG19033.1	CBG19033.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG19033	CBG19033		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065126
• Remark: CBG19033, AATTGTGCACTTTCGACCCTCAACGGTGCATATACTCCCAAAGATTGGAATAATGGATAT, WBGene00038317
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term