WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00177322 Gene Name  CJA21750
Sequence Name  ? CJA21750 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Winged helix DNA-binding domain superfamily; Brf1-like TBP-binding domain; Cullin protein, neddylation domain; Brf1, TBP-binding domain; Cullin-4B; Cullin protein neddylation domain; and Winged helix-like DNA-binding domain superfamily. Is an ortholog of C. elegans cul-4. In C. elegans, cul-4 is involved in proteasome-mediated ubiquitin-dependent protein catabolic process. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA21750.1 CJA21750.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA21750 CJA21750   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-cul-4, GCTCATCGAGCGAGAATACATTGCTCGTGATGAAGAGGACTCGGCCAAGTACAAATACGT, WBGene00137874   Expr1072753 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA21750, AAGCAGGCGAGGAGCAAAAATCTTATTAAATCTGGCGGAACCTCTCTCGAATCTCTCCGA, WBGene00177322   Expr1079132 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term