WormMine: Gene WBGene00037884

• WormBase Gene ID: WBGene00037884
• Gene Name: Cbr-sqv-1
• Sequence Name: CBG18465
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: GDP-mannose 4,6 dehydratase; NAD(P)-binding domain superfamily; and NAD(P)-binding domain. Is an ortholog of C. elegans sqv-1. In C. elegans, sqv-1 is involved in several processes, including egg-laying behavior; pharynx development; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG18465.1	CBG18465.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG18465	CBG18465		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053550
• Remark: Cbr-sqv-1, AGCAGCGGAACAGATTCAATGGAGACCACAAGTACTGATGAAGGATGGTCTTTTGAAGAC, WBGene00037884
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term