WormMine: Gene WBGene00124233

• WormBase Gene ID: WBGene00124233
• Gene Name: CJA05029
• Sequence Name: CJA05029
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans let-413. In C. elegans, let-413 is involved in several processes, including adherens junction assembly; embryonic digestive tract morphogenesis; and maintenance of epithelial cell apical/basal polarity.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05029.1	CJA05029.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05029	CJA05029		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081317
• Remark: Cjp-let-413, AAAGACGCCGAAACACAAGAAGGGATCGATAGATGGACACATGGCGCCGCACGACATTGA, WBGene00124233
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term