WormMine: Gene WBGene00026735

• WormBase Gene ID: WBGene00026735
• Gene Name: CBG03982
• Sequence Name: CBG03982
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domain: PDZ superfamily. Is an ortholog of C. elegans F23C8.13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03982a.1	CBG03982a.1		[unknown]
Transcript:CBG03982b.1	CBG03982b.1		[unknown]
Transcript:CBG03982c.1	CBG03982c.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03982b	CBG03982b		[unknown]
CDS:CBG03982c	CBG03982c		[unknown]
CDS:CBG03982a	CBG03982a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1069814
• Remark: CBG03982, TCCTTTGATACTTCACCTTCCAAAACTATATGCCCACACTGCAATGCTCAAACAAGACTG, WBGene00026735
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term