WormMine: Gene WBGene00181530

• WormBase Gene ID: WBGene00181530
• Gene Name: CJA25958
• Sequence Name: CJA25958
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: PAN-3 domain; C-type lectin-like/link domain superfamily; PAN-like domain; and C-type lectin fold. Is an ortholog of C. elegans Y73F8A.23; Y73F8A.22; and Y44A6B.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA25958.1	CJA25958.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA25958	CJA25958		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1092177
• Remark: CJA25958, GCCGATTTGGCTGGACGGAAATAGTCTCTATACAGCTACACAGTTCATAATGGAAGATTG, WBGene00181530
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term