WormMine: Gene WBGene00180695

• WormBase Gene ID: WBGene00180695
• Gene Name: CJA25123
• Sequence Name: CJA25123
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ribosomal protein S5 domain 2-type fold, subgroup and Ribosomal protein S5 domain 2-type fold.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA25123.1	CJA25123.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA25123	CJA25123		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077902
• Remark: CJA28215, GAGAAGACGTGGATGCTCAAAGACTTGCTAAAAGCGGCCGATCGTCTTGCCGCCGAGTAC, WBGene00183789
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term