WormMine: Gene WBGene00182858

• WormBase Gene ID: WBGene00182858
• Gene Name: CJA27286
• Sequence Name: CJA27286
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: HAD superfamily; haloacid dehalogenase-like hydrolase; and HAD-like superfamily. Is an ortholog of C. elegans Y62E10A.13.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA27286.1	CJA27286.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA27286	CJA27286		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072007
• Remark: CJA27286, CGACACGTCCGAATTGACCAGCGACTCGGGAAGCAAAGATGTAAGAAGAATGATGAATTG, WBGene00182858
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term