WormMine: Gene WBGene00025057

• WormBase Gene ID: WBGene00025057
• Gene Name: CBG01887
• Sequence Name: CBG01887
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans T23E7.2.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG01887f.1	CBG01887f.1		[unknown]
Transcript:CBG01887d.1	CBG01887d.1		[unknown]
Transcript:CBG01887e.1	CBG01887e.1		[unknown]
Transcript:CBG01887a.1	CBG01887a.1		[unknown]
Transcript:CBG01887c.1	CBG01887c.1		[unknown]
Transcript:CBG01887b.1	CBG01887b.1		[unknown]

Other

6 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG01887a	CBG01887a		[unknown]
CDS:CBG01887c	CBG01887c		[unknown]
CDS:CBG01887b	CBG01887b		[unknown]
CDS:CBG01887e	CBG01887e		[unknown]
CDS:CBG01887d	CBG01887d		[unknown]
CDS:CBG01887f	CBG01887f		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1062440
• Remark: CBG01887, CGCCTGGGAAATGTTGTATATGGTGGTTTGTATCGCAAGAAAATCGATCCAGAGCTTGAA, WBGene00025057
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term