WormMine: Gene WBGene00212047

• WormBase Gene ID: WBGene00212047
• Gene Name: Cjp-sel-2.1
• Sequence Name: CJA36200
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: WD domain, G-beta repeat; WD40 repeat; and WD40-repeat-containing domain superfamily. Is an ortholog of C. elegans sel-2. In C. elegans, sel-2 is involved in several processes, including apical protein localization; negative regulation of Notch signaling pathway; and regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA36200.1	CJA36200.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA36200	CJA36200		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1076898
• Remark: CJA25664, CTGGAGCGATTGTCGTCTTCAATTCAGACTTTAACCGATGGCATTACGAATACAAGAATC, WBGene00181236
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term