WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00175890 Gene Name  CJA20318
Sequence Name  ? CJA20318 Organism  Caenorhabditis japonica
Automated Description  Is an ortholog of C. elegans klf-3. In C. elegans, klf-3 is involved in regulation of gene expression and regulation of lipid metabolic process. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA20318a.1 CJA20318a.1   [unknown]
Transcript:CJA20318b.1 CJA20318b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA20318b CJA20318b   [unknown]
CDS:CJA20318a CJA20318a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-mua-1, GGTTCATGAATTGACACCTCCTCATAAAAATGATACACCACCGTCGAGCCCAGAAGGATC, WBGene00175890   Expr1086581 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term