WormMine: Gene WBGene00026611

• WormBase Gene ID: WBGene00026611
• Gene Name: Cbr-epg-8
• Sequence Name: CBG03832
• Organism: Caenorhabditis briggsae
• Automated Description: Is an ortholog of C. elegans epg-8. In C. elegans, epg-8 is involved in macroautophagy; positive regulation of autophagy; and positive regulation of embryonic development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG03832c.1	CBG03832c.1		[unknown]
Transcript:CBG03832b.1	CBG03832b.1		[unknown]
Transcript:CBG03832a.1	CBG03832a.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG03832a	CBG03832a		[unknown]
CDS:CBG03832c	CBG03832c		[unknown]
CDS:CBG03832b	CBG03832b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1058211
• Remark: CBG03832, TCGGAAGTGCACGCTATGATCGAAGCACAGCGCCCGGAGGATTATTCCAAAAAGGATGAA, WBGene00026611
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term