WormMine: Gene WBGene00039701

• WormBase Gene ID: WBGene00039701
• Gene Name: Cbr-tbc-14
• Sequence Name: CBG20779
• Organism: Caenorhabditis briggsae
• Automated Description: Is predicted to encode a protein with the following domains: Rab-GTPase-TBC domain; Small G protein signalling modulator 1/2, Rab-binding domain; Rab-binding domain (RBD); and Rab-GTPase-TBC domain superfamily. Is an ortholog of C. elegans tbc-14.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG20779.1	CBG20779.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG20779	CBG20779		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1050839
• Remark: CBG20779, CCGAGGATCAGGAGAAACGGTTCTCGAAATTTGTGAAGCGCAAGTCGCTTGTAGAGAAAG, WBGene00039701
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term