WormMine: Gene WBGene00120491

• WormBase Gene ID: WBGene00120491
• Gene Name: Cjp-ifb-1
• Sequence Name: CJA01287
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Lamin tail domain; Intermediate filament, rod domain; Lamin tail domain superfamily; Intermediate filament protein; Intermediate filament, ifa/ifb; and Lamin Tail Domain. Is an ortholog of C. elegans ifb-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA01287.1	CJA01287.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA01287	CJA01287		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1090249
• Remark: Cjp-ifb-1, AACAAGGACGGCGAGGAGCGCGCCACGCACACCCAAAAGACCATCCAGTCGGGACAATAA, WBGene00120491
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term