WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00030812 Gene Name  Cbr-clk-2
Sequence Name  ? CBG09171 Organism  Caenorhabditis briggsae
Automated Description  Is predicted to encode a protein with the following domains: TEL2, C-terminal domain superfamily; Telomere length regulation protein; and Telomere length regulation protein, conserved domain. Is an ortholog of C. elegans clk-2. In C. elegans, clk-2 is involved in several processes, including DNA damage checkpoint signaling; determination of adult lifespan; and response to radiation. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG09171.1 CBG09171.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG09171 CBG09171   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-clk-2, GATTTTCGGAAAATACGAAACTTCGCTCTGCCAGCCTAGCCGCCTATCTTAATGTGTTGT, WBGene00030812   Expr1063647 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term