WormMine: Gene WBGene00123141

• WormBase Gene ID: WBGene00123141
• Gene Name: Cjp-mtm-5
• Sequence Name: CJA03937
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: DENN domain, C-terminal lobe; Myotubularin-like phosphatase domain; Myotubularin family; GRAM domain; Pleckstrin homology domain; PH domain; Protein-tyrosine phosphatase-like; cDENN domain; dDENN domain; PH-like domain superfamily; SBF1/SBF2 domain; Myotubularin protein; and DENN (AEX-3) domain. Is an ortholog of C. elegans mtm-5.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA03937.1	CJA03937.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA03937	CJA03937		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1079139
• Remark: Cjp-mtm-5, CTGTACAGGATATCTGAGCAAGCGTGGGGCTAAACTGAAGTTGTGGGTGCCGCGATTTTT, WBGene00123141
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term