WormMine: Gene WBGene00122125

• WormBase Gene ID: WBGene00122125
• Gene Name: Cjp-mtm-1
• Sequence Name: CJA02921
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Myotubularin-like phosphatase domain; Myotubularin family; GRAM domain; Protein-tyrosine phosphatase-like; PH-like domain superfamily; and Protein-tyrosine phosphatase, catalytic. Is an ortholog of C. elegans mtm-1. In C. elegans, mtm-1 is involved in negative regulation of engulfment of apoptotic cell and phospholipid dephosphorylation.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02921.1	CJA02921.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02921	CJA02921		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1075160
• Remark: Cjp-mtm-1, AAAAAGTATTGTTTGTGAATCCTACATTCTGTCTTCTTCAAGTGTGGACCGACTATTACG, WBGene00122125
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term