WormMine: Gene WBGene00121906

• WormBase Gene ID: WBGene00121906
• Gene Name: Cjp-hoe-1
• Sequence Name: CJA02702
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Ribonuclease Z/Hydroxyacylglutathione hydrolase-like; Metallo-beta-lactamase; and Beta-lactamase superfamily domain. Is an ortholog of C. elegans hoe-1. In C. elegans, hoe-1 is involved in nematode larval development; positive regulation of vulval development; and sexual reproduction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02702.1	CJA02702.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02702	CJA02702		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1089588
• Remark: Cjp-hoe-1, GAATATCTTGATGAACTGAACATTGGAGTAGCCATGGATATGCTCAGAGTACGATTCGAT, WBGene00121906
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term