WormMine: Gene WBGene00121872

• WormBase Gene ID: WBGene00121872
• Gene Name: Cjp-gcp-2.1
• Sequence Name: CJA02668
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Transferrin receptor-like, dimerisation domain superfamily; PA domain; Transferrin receptor-like dimerisation domain; Glutamate carboxypeptidase 2-like; Peptidase M28; Transferrin receptor-like, dimerisation domain; and Peptidase family M28. Is an ortholog of C. elegans gcp-2.1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA02668.1	CJA02668.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA02668	CJA02668		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1073702
• Remark: CJA08960, AGCTACAAAAACTACTCGACATTTGATACTTATCCATTGTATCATACTATGTATGAAACA, WBGene00128164
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term