WormMine: Gene WBGene00124904

• WormBase Gene ID: WBGene00124904
• Gene Name: CJA05700
• Sequence Name: CJA05700
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domain: Leucine-rich repeat domain superfamily. Is an ortholog of C. elegans T05H4.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

4 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA05700d.1	CJA05700d.1		[unknown]
Transcript:CJA05700c.1	CJA05700c.1		[unknown]
Transcript:CJA05700b.1	CJA05700b.1		[unknown]
Transcript:CJA05700a.1	CJA05700a.1		[unknown]

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA05700d	CJA05700d		[unknown]
CDS:CJA05700a	CJA05700a		[unknown]
CDS:CJA05700c	CJA05700c		[unknown]
CDS:CJA05700b	CJA05700b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071729
• Remark: CJA05700, TGTTTGAAGACAATCGCAGTTACCGATGGACAAGTTTTACAGCCATTTCAGTCGTTGGAA, WBGene00124904
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term