WormMine: Gene WBGene00176891

• WormBase Gene ID: WBGene00176891
• Gene Name: CJA21319
• Sequence Name: CJA21319
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Pleckstrin homology domain; PH domain; and PH-like domain superfamily. Is an ortholog of C. elegans akt-2. In C. elegans, akt-2 is involved in determination of adult lifespan; insulin receptor signaling pathway; and regulation of synaptic assembly at neuromuscular junction.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA21319a.1	CJA21319a.1		[unknown]
Transcript:CJA21319c.1	CJA21319c.1		[unknown]
Transcript:CJA21319b.1	CJA21319b.1		[unknown]

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA21319a	CJA21319a		[unknown]
CDS:CJA21319c	CJA21319c		[unknown]
CDS:CJA21319b	CJA21319b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1081292
• Remark: CJA21319, GCCGAAAGAGGGACAACCGTATCCAGAACCGCTCAATGACTTTATGATTAAGGATGCAGC, WBGene00176891
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term