WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00176686 Gene Name  CJA21114
Sequence Name  ? CJA21114 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and Ankyrin repeat. Is an ortholog of C. elegans fem-1. In C. elegans, fem-1 is involved in several processes, including proteasome-mediated ubiquitin-dependent protein catabolic process; regulation of germ cell proliferation; and sex determination. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA21114a.1 CJA21114a.1   [unknown]
Transcript:CJA21114b.1 CJA21114b.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA21114a CJA21114a   [unknown]
CDS:CJA21114b CJA21114b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cjp-fem-1, AAACTGATTGGTGCAACTTTTATGGACAAGAAAATGGATGCGATGGCGGCGATGGACTAT, WBGene00176686   Expr1085057 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term