WormMine: Gene WBGene00176686

• WormBase Gene ID: WBGene00176686
• Gene Name: CJA21114
• Sequence Name: CJA21114
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Domain of unknown function DUF3447; Ankyrin repeat-containing domain superfamily; Ankyrin repeats (3 copies); and Ankyrin repeat. Is an ortholog of C. elegans fem-1. In C. elegans, fem-1 is involved in several processes, including proteasome-mediated ubiquitin-dependent protein catabolic process; regulation of germ cell proliferation; and sex determination.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA21114a.1	CJA21114a.1		[unknown]
Transcript:CJA21114b.1	CJA21114b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA21114a	CJA21114a		[unknown]
CDS:CJA21114b	CJA21114b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1085057
• Remark: Cjp-fem-1, AAACTGATTGGTGCAACTTTTATGGACAAGAAAATGGATGCGATGGCGGCGATGGACTAT, WBGene00176686
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term