WormMine: Gene WBGene00060204

• WormBase Gene ID: WBGene00060204
• Gene Name: Cre-tbc-11
• Sequence Name: CRE17212
• Organism: Caenorhabditis remanei
• Automated Description: Is predicted to encode a protein with the following domains: PTB/PI domain; Rab-GTPase-TBC domain; Rab-GTPase-TBC domain superfamily; Rab GTPase-activating protein 1; Kinesin protein; PH-like domain superfamily; and Kinesin-like. Is an ortholog of C. elegans tbc-11. In C. elegans, tbc-11 is involved in RNA localization and cuticle development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE17212.1	CRE17212.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE17212	CRE17212		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1117224
• Remark: CRE17212, AAATTGAGACTTCTGCAAATGCCATTGAGCGACTGACACGACAGAATCAAGACATTCTGG, WBGene00060204
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term