WormMine: Gene WBGene00127648

• WormBase Gene ID: WBGene00127648
• Gene Name: Cjp-egl-26
• Sequence Name: CJA08445
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Lecithin retinol acyltransferase and LRAT domain. Is an ortholog of C. elegans egl-26. In C. elegans, egl-26 is involved in several processes, including egg-laying behavior; positive regulation of vulval development; and vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA08445.1	CJA08445.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA08445	CJA08445		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1083780
• Remark: Cjp-egl-26, GTACGATATGACTTCCAGCTTTAAATACTTGGCGTGTACCGTGTTAAAACCAACGTCTAC, WBGene00127648
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term