WormMine: Gene WBGene00129975

• WormBase Gene ID: WBGene00129975
• Gene Name: Cjp-egl-43
• Sequence Name: CJA10771
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Zinc finger, C2H2 type; Zinc finger C2H2 superfamily; and Zinc finger C2H2-type. Is an ortholog of C. elegans egl-43. In C. elegans, egl-43 is involved in several processes, including regulation of developmental process; regulation of mitotic cell cycle; and regulation of transcription by RNA polymerase II.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10771.1	CJA10771.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10771	CJA10771		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1077694
• Remark: Cjp-egl-43, GCCGAACGGTGGAGTGCCAAAGGACAAGTACACGTGCAAGTTTTGTCAGAAAGTGTTTCC, WBGene00129975
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term