WormMine: Gene WBGene00129108

• WormBase Gene ID: WBGene00129108
• Gene Name: Cjp-mtm-9
• Sequence Name: CJA09904
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Protein-tyrosine phosphatase-like; Myotubularin family; PH-like domain superfamily; and Myotubularin-like phosphatase domain. Is an ortholog of C. elegans mtm-9. In C. elegans, mtm-9 is involved in pinocytosis and regulation of cell migration.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA09904.1	CJA09904.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA09904	CJA09904		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1071101
• Remark: Cjp-mtm-9, AACGTGGCACAGTGTATTTATAGTGAAGGATGCAAAGAAGTTCCGGTGGTGATTCATGGC, WBGene00129108
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term