WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00129176 Gene Name  CJA09972
Sequence Name  ? CJA09972 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: FERM, N-terminal; Band 4.1 domain; FERM N-terminal domain; FERM superfamily, second domain; Ubiquitin-like domain superfamily; and FERM/acyl-CoA-binding protein superfamily. Is an ortholog of C. elegans frm-1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

3 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA09972b.1 CJA09972b.1   [unknown]
Transcript:CJA09972a.1 CJA09972a.1   [unknown]
Transcript:CJA09972c.1 CJA09972c.1   [unknown]
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA09972c CJA09972c   [unknown]
CDS:CJA09972b CJA09972b   [unknown]
CDS:CJA09972a CJA09972a   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA15344, GCGGAAGATTTTCCGAAACAGGCACATCGTGTTTCCGACCAATTGGACTTCTTCAAAATT, WBGene00134548   Expr1075706 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
CJA06720, CGAGATATTCAAAGAACCCCGTACTATCAGCGCCTTTATCGGCAAGTTGTTATGGAAACT, WBGene00125924   Expr1078717 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term