WormMine: Gene WBGene00129478

• WormBase Gene ID: WBGene00129478
• Gene Name: CJA10274
• Sequence Name: CJA10274
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: BTB/POZ domain; SKP1/BTB/POZ domain superfamily; BTB/Kelch-associated; PHR domain superfamily; BTB And C-terminal Kelch; PHR domain; and PHR. Is an ortholog of C. elegans tag-30.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10274a.1	CJA10274a.1		[unknown]
Transcript:CJA10274b.1	CJA10274b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10274a	CJA10274a		[unknown]
CDS:CJA10274b	CJA10274b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1091168
• Remark: CJA10274, TTCACTGATATCGATTTGGATACTTTATGCGAAGTTCTAACAAGAGATGGATTACGCGTA, WBGene00129478
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term