WormMine: Gene WBGene00129351

• WormBase Gene ID: WBGene00129351
• Gene Name: Cjp-mrck-1
• Sequence Name: CJA10147
• Organism: Caenorhabditis japonica
• Automated Description: Is predicted to encode a protein with the following domains: Phorbol esters/diacylglycerol binding domain (C1 domain); Protein kinase C-like, phorbol ester/diacylglycerol-binding domain; CNH domain; Pleckstrin homology domain; PH-like domain superfamily; and Citron homology (CNH) domain. Is an ortholog of C. elegans mrck-1. In C. elegans, mrck-1 is involved in several processes, including embryonic body morphogenesis; positive regulation of endocytic recycling; and regulation of Golgi organization.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA10147b.1	CJA10147b.1		[unknown]
Transcript:CJA10147a.1	CJA10147a.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA10147b	CJA10147b		[unknown]
CDS:CJA10147a	CJA10147a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

• WormBaseAcedbConverter

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1072842
• Remark: Cjp-tag-59, TCCGAAAACGAGATTGACATTTTCAATGTGACACTGGCCGAATGGGTTCAAACGATCAAT, WBGene00129351
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term