WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00061561 Gene Name  CRE13285
Sequence Name  ? CRE13285 Organism  Caenorhabditis remanei
Automated Description  Is predicted to encode a protein with the following domains: Protein of unknown function (DUF851) and Protein of unknown function DUF851. Is an ortholog of C. elegans W03G1.2; Y52D5A.1; and Y75B7B.1. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis remanei 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CRE13285.1 CRE13285.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CRE13285 CRE13285   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CRE13285, AACGACAAGAATCCAGTGATAATGAACTCGTTCCAACCGATGAGTGAGCTCAGGAAACGA, WBGene00061561   Expr1094684 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term